Review



reverse oligonucleotide primer  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    New England Biolabs reverse oligonucleotide primer
    Reverse Oligonucleotide Primer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1633 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse oligonucleotide primer/product/New England Biolabs
    Average 97 stars, based on 1633 article reviews
    reverse oligonucleotide primer - by Bioz Stars, 2026-05
    97/100 stars

    Images



    Similar Products

    reverse oligonucleotide primer  (New England Biolabs)
    97
    New England Biolabs reverse oligonucleotide primer
    Reverse Oligonucleotide Primer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse oligonucleotide primer/product/New England Biolabs
    Average 97 stars, based on 1 article reviews
    reverse oligonucleotide primer - by Bioz Stars, 2026-05
    97/100 stars
    		  Buy from Supplier
    reverse mutagenic oligonucleotide primers  (Eurofins)
    86
    Eurofins reverse mutagenic oligonucleotide primers
    Reverse Mutagenic Oligonucleotide Primers, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse mutagenic oligonucleotide primers/product/Eurofins
    Average 86 stars, based on 1 article reviews
    reverse mutagenic oligonucleotide primers - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier
    oligonucleotides used for shape map library preparation 1 p53 rt primer tccactcggataagatgct 2 p53 forward atggaggagccgcagtcagat 3 p53 reverse tccactcggataagatgct  (Eurofins)
    86
    Eurofins oligonucleotides used for shape map library preparation 1 p53 rt primer tccactcggataagatgct 2 p53 forward atggaggagccgcagtcagat 3 p53 reverse tccactcggataagatgct
    Oligonucleotides Used For Shape Map Library Preparation 1 P53 Rt Primer Tccactcggataagatgct 2 P53 Forward Atggaggagccgcagtcagat 3 P53 Reverse Tccactcggataagatgct, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotides used for shape map library preparation 1 p53 rt primer tccactcggataagatgct 2 p53 forward atggaggagccgcagtcagat 3 p53 reverse tccactcggataagatgct/product/Eurofins
    Average 86 stars, based on 1 article reviews
    oligonucleotides used for shape map library preparation 1 p53 rt primer tccactcggataagatgct 2 p53 forward atggaggagccgcagtcagat 3 p53 reverse tccactcggataagatgct - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier
    lamp2a sgrna reverse primer fisher scientific custom dna oligonucleotides  (Fisher Scientific)
    90
    Fisher Scientific lamp2a sgrna reverse primer fisher scientific custom dna oligonucleotides
    Lamp2a Sgrna Reverse Primer Fisher Scientific Custom Dna Oligonucleotides, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lamp2a sgrna reverse primer fisher scientific custom dna oligonucleotides/product/Fisher Scientific
    Average 90 stars, based on 1 article reviews
    lamp2a sgrna reverse primer fisher scientific custom dna oligonucleotides - by Bioz Stars, 2026-05
    90/100 stars
    		  Buy from Supplier
    reverse-transcribed oligonucleotide (dt) primers  (Spatial Transcriptomics Inc)
    90
    Spatial Transcriptomics Inc reverse-transcribed oligonucleotide (dt) primers
    Reverse Transcribed Oligonucleotide (Dt) Primers, supplied by Spatial Transcriptomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse-transcribed oligonucleotide (dt) primers/product/Spatial Transcriptomics Inc
    Average 90 stars, based on 1 article reviews
    reverse-transcribed oligonucleotide (dt) primers - by Bioz Stars, 2026-05
    90/100 stars
    		  Buy from Supplier
    oligonucleotides reverse primer  (Macrogen)
    90
    Macrogen oligonucleotides reverse primer
    Oligonucleotides Reverse Primer, supplied by Macrogen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotides reverse primer/product/Macrogen
    Average 90 stars, based on 1 article reviews
    oligonucleotides reverse primer - by Bioz Stars, 2026-05
    90/100 stars
    		  Buy from Supplier
    oligonucleotide primers for real-time reverse transcription-qpcr  (Bioneer Corporation)
    90
    Bioneer Corporation oligonucleotide primers for real-time reverse transcription-qpcr
    Oligonucleotide Primers For Real Time Reverse Transcription Qpcr, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotide primers for real-time reverse transcription-qpcr/product/Bioneer Corporation
    Average 90 stars, based on 1 article reviews
    oligonucleotide primers for real-time reverse transcription-qpcr - by Bioz Stars, 2026-05
    90/100 stars
    		  Buy from Supplier
    oligonucleotides primer: hsqle-reverse  (Sangon Biotech)
    90
    Sangon Biotech oligonucleotides primer: hsqle-reverse
    Oligonucleotides Primer: Hsqle Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotides primer: hsqle-reverse/product/Sangon Biotech
    Average 90 stars, based on 1 article reviews
    oligonucleotides primer: hsqle-reverse - by Bioz Stars, 2026-05
    90/100 stars
    		  Buy from Supplier
    oligonucleotides primer: hmylip-reverse  (Sangon Biotech)
    90
    Sangon Biotech oligonucleotides primer: hmylip-reverse
    Oligonucleotides Primer: Hmylip Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotides primer: hmylip-reverse/product/Sangon Biotech
    Average 90 stars, based on 1 article reviews
    oligonucleotides primer: hmylip-reverse - by Bioz Stars, 2026-05
    90/100 stars
    		  Buy from Supplier

    Image Search Results